Skip to main content

Table 1 Primers and UPL probes used in the real-time reverse-transcriptase polymerase chain reaction experiments

From: High-efficiency Rosa26 knock-in vector construction for Cre-regulated overexpression and RNAi

Transcript Forward Reverse Probe
Oct4 GTTGGAGAAGGTGGAACCAA CTCCTTCTGCAGGGCTTTC 95
β-actin AAGGCCAACCGTGAAAAGAT GTGGTACGACCAGAGGCATAC 56
Gata4 GGAAGACACCCCAATCTCG CATGGCCCCACAATTGAC 13
Fgf5 AAAACCTGGTGCACCCTAGA CATCACATTCCCGAATTAAGC 29
Brachyury CGACCACAAAGATGTAATGGAG CCAGCACCAGGAACAAGC 66
Hand1 AGCGGAAAAGGGAGTTGC GCGCCCTTTAATCCTCTTCT 51
Cdx2 CTGCCACACTTGGGCTCT CTTGGCTCTGCGGTTCTG 34
Human β-catenin GCAGAGTGCTGAAGGTGCTA TCTGTCAGGTGAAGTCCTAAAGC 31
Mouse β-catenin ATGAAGGCGTGGCAACATAC TGTGGCTTGTCCTCAGACAT 56